3.4 Case Studies 3.4.1 Biofuel from GM Macro algae Hydrocarbon biofuels are produced by genetically modified seaweed which are obtained by inserting genes from high hydrocarbon producing micro algae into high growth seaweed species. Botryococcus braunii (BB) a green micro algae that produces large amounts of aliphatic hydrocarbon molecules is used as a source for genetic material. The genes that produce hydrocarbon in BB are identified, removed, cloned and subsequently inserted into high…
3.3 Results and Discussion 3.3.1 Agarose Particles By microscopy observation, both ABT and CSS were activated by the Mix&GoTM solution with significant colour change on the particle surface. Seen from Figure 3-1 and 3-2, a dark green layer was formed outside the particle after treating with Mix&GoTM. By visual observation, the agarose particles turned from colourless to green, which supported the microscopy observation. The activated particles were also sent for zeta potential measurement and…
Introduction Biotechnology has been providing the world with a large variety of options as to how we can use commercial land as well as agriculture. It has allowed people to exchange genetic materials among living organisms. In this research task I have researched the definition of genetic engineering as well has genetically modified crops and I have stated the advantages and disadvantages of GM crops. Ethical issues as well as various types of GM crops will be discussed. Definitions: Genetic…
The human genome is composed of millions of molecules of DNA perfectly packaged into 23 chromosomes. Each human is the result of a combination of the same four nucleotides, yet every single one is unique. Perhaps, this is due to the slight variation in each human’s DNA, or maybe the explanation lies in a person’s upbringing. The purpose of studying human development is to understand why people change by applying the scientific method to existing theories, which provide the basis for…
Alex and Me is a book written by Irene M. Pepperberg, a scientist who mainly focusses on animal behavior, animal cognition, and comparative psychology. Pepperberg was born on April 1, 1949 in Brooklyn, New York. She received her M.A. and Ph.D. from Harvard University and her B.S. from Massachusetts Institute of Technology. After this, she became a psychology professor at Brandeis University, where she also became involved in wildlife conservation. Alex and Me is about a parrot who becomes very…
According to http://www.encyclopedia.com, DNA which stands for deoxyribonucleic acid is used for human genetic makeup. It has different sequences of bases and exist in human body. The sequence of it nucleotides are A, T, G, C; or, adenine, thymine, guanine, and cytosine, respectively. A DNA fingerprinting, is a DNA pattern that has a unique sequence such that it can be distinguished from the DNA patterns of other individual. The two major uses for the information is for personal identification…
In the first infected group of mice, after a month, the mice were killed and the CD4+ T cells were purified from the spleen to be sequenced. They extracted the DNA using the MasterPureTM DNA purification kit and then subjected the CCR5 ZFN binding site to PCR amplification for 25 cycles. After PCR amplification and gel purification the sequence was subject to a modified Surveyor nuclease assay to determine CCR5 disruption frequency. Surveyor nuclease assays are used to detect single base…
PCR Amplification Desired DNA was amplified in 200µL PCR tubes. WtfolA PCR tubes contained 0.1584ng/µL wildtype folA derived from pMAC1-wtfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, CGGCAGCCATATGATCAGTCTGATTGCGGC) and 0.2µM reverse primer (MOBIX, GTGCTCGAGCCGCCGCTCCAGAATCT). MutfolA PCR tubes contained 4ng/µL mutant folA derived from pET28b-mutfolA (biochemistry teaching labs), 0.2µM forward primer (MOBIX, GACGGACACATATGATCAGTCTGATTGCGGCG) and 0.2µM reverse primer (MOBIX,…
Such a protease was identified in the latex of Vallaris solanacea. Further study aimed at performing preliminary investigations on protease, purification, molecular weight determination and further characterization of Vallaris solanacea derived protease solanain [29]. The latex of Vallaris solanacea has high proteolytic activity, the activity being comparable to those of other known latex proteases such as papain…
Regeneration is the process of renewal or restoration of a body, part of the body or biological system after a wound or as a normal process. It is the process that makes the genomes, cells and organisms flexible to natural changes that cause disturbances or damage. All species are able to regenerate from bacteria to humans. Regeneration can be of two types: it can be complete when the new tissue is equal to the lost or incomplete tissue when the necrotic tissue presents fibrosis. Different…